EpiDyne® Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated

$565.00
SKU: 16-4112
Pack Size: 50 µg
EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated Description: Mononucleosomes assembled from recombinant human histones expressed in E. coli (two each of histones H2A, H2B, H3 and H4. Accession numbers: H2A-P04908; H2B-O60814; H3.1-P68431; H4-P62805) wrapped by provided 217 base pair DNA sequence that includes the Widom 601 sequence with two added GATC sequences and a 5' biotin-TEG group.

EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated Formulation: Purified recombinant mononucleosomes in 10mM Tris-HCl pH 7.5, 25 mM NaCl, 1 mM EDTA, 2 mM DTT, 20% glycerol. MW = 243,101.5 Da.

EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated Storage and Stability: Stable for six months at -80°C from date of receipt. For best results, aliquot and avoid multiple freeze/thaws.

EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated Application Notes: This product is a template for nucleosome remodeling assays using the restriction enzyme DpnII to determine accessibility of GATCs which is masked in its native configuration (prior to remodeling). DNA Sequence: GAATTCATCAGAATCCCGGTGCCGAGGCCGATCAATTGATCGTAGACAGCTCTAGCACCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTT AACCGCCAAGGGGATTACTCCCTAGTCTCCAGGCACGTGTCAGATATATACATCGATGATGATGGATAGATGGATGATGGATGGATGGATGATGA TGGATGAATAGATGGATGGATGAAGCTT
References:


View technical datasheet for this product. 16-4112 Datasheet

View Restriction Enzyme Assay application technical note for this product. 16-4112 Tech Note

16-4112 DNAGel
DNA Gel Data: Free DNA (Lane 1, 100 ng) and EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated (Lane 2, 400 ng) resolved via native page and stained with ethidium bromide to visualize DNA.
16-4112 Protein Gel
Protein Gel Data: Histone proteins in EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated resolved via SDS-PAGE and coomassie staining (2 ug). Sizes of molecular weight markers and positions of the core histones (H2A, H2B, H3 and H4) are indicated.
16-4112 REA Gel
Nucleosome Remodeling Data: ACF/ATP-dependent nucleosome remodeling reaction in the presence of DpnII restriction enzyme. EpiDyne Nucleosome Remodeling Assay Substrate ST601-GATC1,2, Biotinylated nucleosomes incubated with (10nM) or without ACF for up to 20 minutes in the presence of 2 mM ATP and 50U of DpnII. Samples were quenched at specified intervals and run on 8% native PAGE gel.
Current stock: 0